Primerdesign

aus Wikipedia, der freien Enzyklopädie
Zur Navigation springen Zur Suche springen

Das Primerdesign (IPA: [ˊpʁaɪ̯mɐ dɪˈzaɪn]) bezeichnet in der Biochemie Verfahren zum rationalen Design von Oligonukleotiden zur Verwendung als Primer in einer Polymerase-Kettenreaktion oder verwandten Methoden.[1][2] Das Primerdesign ist eine Methode zur PCR-Optimierung.

Eigenschaften[Bearbeiten | Quelltext bearbeiten]

DNA-Polymerasen (auch thermostabile DNA-Polymerasen) benötigen eine Hydroxygruppe als Startpunkt für ihre erste Verknüpfungsreaktion. Primer stellen mit ihrem 3'-OH-Ende eine passende Hydroxyfunktion zur Verfügung. Primer können sowohl aus DNA als auch aus RNA bestehen.

Auch bei der In-vitro-Amplifikation von DNA, beispielsweise bei der Polymerase-Kettenreaktion (PCR), der DNA-Sequenzierung oder bei der reversen Transkription, werden Primer benötigt. Hier lässt sich mit Hilfe der Primer der spezifische DNA-Abschnitt, der amplifiziert werden soll, festlegen.

Für die PCR werden deshalb Nukleotidsequenzen, die den zu amplifizierenden DNA-Abschnitt flankieren, bestimmt. Gemäß diesen Sequenzen werden nun passende Primersequenzen per Phosphoramidit-Synthese hergestellt. Ein Primer repräsentiert hierbei jeweils den gegenläufigen Strang zu seinem „Primerpartner“. Primer für PCR-Ansätze haben in der Regel eine Länge von 18–30 Nukleotiden. Diverse Biotechnologiefirmen bieten mittlerweile maßgeschneiderte Primer für molekularbiologische Anwendungen an. Durch maßgeschneiderte Missmatchprimer lassen sich über die PCR-Technik auch gezielt Mutationen in Gene einführen, die z. B. im Austausch einer Aminosäure bestehen.

Sekundärstrukturen[Bearbeiten | Quelltext bearbeiten]

Das Vorhandensein von Guanosin oder Cytosin in den letzten fünf Basen eines Primers erhöht die Spezifität der Primerbindung (engl. GC-clamp ‚GC-Klammer‘). Die Primersequenz wird zur Vermeidung von Homologien mit einer Datenbank abgeglichen. Die Sequenz des Primers wird auf mögliche Hybridisierungen mit seinesgleichen oder mit dem anderen Primer (engl. Primer-Dimer) und Sekundärstrukturen (engl. DNA-Hairpin ‚DNA-Haarnadelschleife‘) geprüft, die eine korrekte Primerbindung verhindern können. Da Wiederholungen von einem (engl. nucleotide runs ‚Nukleotid-Läufe‘) und zwei Nukleotiden (engl. dinucleotide repeats ‚Dinukleotid-Wiederholungen‘) zu einer fehlerhaften Primerbindung führen können, werden vier oder mehr solcher Sequenzmotive ebenfalls vermieden.

Temperaturbedingungen[Bearbeiten | Quelltext bearbeiten]

Hybridisierungstemperatur (auch Annealing-Temperatur)[Bearbeiten | Quelltext bearbeiten]

Der zur PCR verwendete Primer (bei DNA-Sequenzierungen) oder das Primerpaar (bei DNA-Amplifikationen) besteht zumeist aus DNA. Im gegebenen Zusammenhang wird eine Hybridisierung im Englischen als annealing bezeichnet, die Hybridisierungsstemperatur entsprechend als Annealing-Temperatur Ta. Jene wie auch die Schmelztemperatur TM eines Primers nehmen mit dessen Länge zu. Die optimale Hybridisierungstemperatur beträgt:[3][4]

Ta = 0,3 × TM + 0,7 × TM' - 14,9;

hierbei ist TM' die Schmelztemperatur des PCR-Produkts. TM und TM' können mit Formeln genähert werden, die in der gleichen Quelle[3] angegeben sind.

Schmelztemperatur[Bearbeiten | Quelltext bearbeiten]

Primer werden mit dem Ziel entworfen, an spezifischer Stelle mit dem DNA-Template zu binden und so gezielte PCR-Produkte oder Hybridisierungen zu ermöglichen. Nebst den Reaktionsbedingungen (Temperatur, Puffer, Konzentrationen von Template und Primer) spielt auch der Aufbau des Primers selbst eine entscheidende Rolle. Die Schmelztemperatur (TM) eines Primers hängt von seiner Länge und seiner Zusammensetzung (GC-Gehalt) ab. Die Länge des Primers (typisch 18 bis 30 Nukleotide) wird so gewählt, dass seine Schmelztemperatur passend zur Annealing-Temperatur des PCR- oder Hybridisierungs-Prozesses ist (siehe Ablauf einer PCR-Reaktion). Der Primer wird zur Steigerung der Spezifität der PCR meistens in einer Länge entworfen, die einer Schmelztemperatur von fünf bis maximal zwanzig Grad Celsius unterhalb der Temperatur des Elongationszyklus der verwendeten Polymerase entspricht. Eine zu niedrige Schmelztemperatur des Primers kann zu falsch positiven Ergebnissen führen, eine zu hohe Schmelztemperatur des Primers führt zu einer niedrigeren Effizienz der Hybridisierung und somit zu einer niedrigeren Produktkonzentration. Der GC-Gehalt spielt eine besondere Rolle, da die Doppelhelix durch eine hohe Anzahl aufeinander folgender GC-Paarungen auf Grund von Stapelwechselwirkungen stabiler ist. Die Schmelztemperatur nimmt also mit der Anzahl an G- und C-Nukleotiden zu. Die Schmelztemperatur (in Grad Celsius) lässt sich mit mehreren Methoden berechnen:

  • die Wallace-Regel:
  • die GC-Methode ist die einfachste aber auch ungenaueste Methode:
  • die „salt adjusted“-Methode ist etwas genauer und bezieht die Konzentration an Na+-Ionen im Reaktionsansatz mit ein:
  • die komplizierteste Methode ist die „base stacking“-Methode, bei der die Enthalpie- und Entropieterme der Helixbildung bei der Hybridisierung mit einbezogen werden:

Mittlerweile gibt es aber eine große Anzahl an Software, mit der man die Schmelztemperatur von Primern berechnen kann.

Degenerierte Primer[Bearbeiten | Quelltext bearbeiten]

Degenerierte Primer werden verwendet, um mehrere homologe Gene (in verschiedenen Spezies) oder paraloge Gene (innerhalb einer Spezies) mit einem Primerpaar zu amplifizieren.[5][6] Sie spielen auch eine entscheidende Rolle bei der de novo Sequenzierung von bislang unbekannten Gensequenzen, wenn also auch die Primer-Target-Sequenzen unbekannt sind.

Bei degenerierten Primern handelt es sich prinzipiell um ein Gemisch aus ähnlichen Primer-Sequenzen, die in einem degenerierten Code zusammengefasst werden. Degenerierte Primer können also auch dann noch auf eine Target-Sequenz passen, wenn diese sich im Laufe der Evolution verändert hat.

So steht beispielsweise die Sequenz

  • 5'-NTAACGTATGCGATATCGGS-3'

für ein Gemisch der Sequenzen

  • ATAACGTATGCGATATCGGC
  • TTAACGTATGCGATATCGGC
  • GTAACGTATGCGATATCGGC
  • CTAACGTATGCGATATCGGC
  • ATAACGTATGCGATATCGGG
  • TTAACGTATGCGATATCGGG
  • GTAACGTATGCGATATCGGG
  • CTAACGTATGCGATATCGGG

da N für A,G,C oder T und S für G oder C steht.

Weitere IUPAC-Abkürzungen sind:

R: A oder G (Purine)

Y: C oder T (Pyrimidine)

W: A oder T

K: G oder T

M: A oder C

B: C, G oder T

D: A, G oder T

H: A, C oder T

V: A, C oder G

Bei degenerierten Primern stellt das Primerdesign eine besondere Herausforderung dar. Primereigenschaften und mögliche Primer-Primer Interaktionen sowie mögliches Target-Mispriming müssen für jede der möglichen Sequenzen separat untersucht werden. Eine Vielzahl verschiedener Software Tools wurde speziell zum Design degenerierter Primer basierend auf Alignments oder Konsensus-Sequenzen entwickelt (z. B. easyPAC)

Allelspezifität[Bearbeiten | Quelltext bearbeiten]

Allelspezifische Oligonukleotide können an bestimmte SNP binden.

Weblinks[Bearbeiten | Quelltext bearbeiten]

Einzelnachweise[Bearbeiten | Quelltext bearbeiten]

  1. L. Y. Chuang, Y. H. Cheng, C. H. Yang: Specific primer design for the polymerase chain reaction. In: Biotechnol Lett. (2013), PMID 23794048.
  2. K. Nybo: Primer design. In: Biotechniques (2013), Band 54, Nr. 5, S. 249–250. PMID 23805429.
  3. a b W. Rychlik, W. J. Spencer, R. E. Rhoads: Optimization of the annealing temperature for DNA amplification in vitro. In: Nucleic Acids Res.. 18, Nr. 21, November 1990, S. 6409–12. doi:10.1093/nar/18.21.6409. PMID 2243783. PMC 332522 (freier Volltext).
  4. W. Rychlik: Priming efficiency in PCR. In: BioTechniques. 18, Nr. 1, Januar 1995, S. 84–6, 88–90. PMID 7702859.
  5. H. Telenius, N. P. Carter, C. E. Bebb, M. Nordenskjöld, B. A. Ponder, A. Tunnacliffe: Degenerate oligonucleotide-primed PCR: general amplification of target DNA by a single degenerate primer. In: Genomics. Band 13, Nummer 3, Juli 1992, S. 718–725, PMID 1639399.
  6. J. A. Iserte, B. I. Stephan, S. E. Goñi, C. S. Borio, P. D. Ghiringhelli, M. E. Lozano: Family-specific degenerate primer design: a tool to design consensus degenerated oligonucleotides. In: Biotechnol Res Int. (2013), S. 383646. doi:10.1155/2013/383646. PMID 23533783; PMC 3600133 (freier Volltext).