Telomer

aus Wikipedia, der freien Enzyklopädie
(Weitergeleitet von Telomere)
Wechseln zu: Navigation, Suche
Übergeordnet
Chromosom
Untergeordnet
Proteinkomplexe
Gene Ontology
QuickGO

Die Telomere (gr. τέλος télos „Ende“ und μέρος méros „Teil“) sind die aus repetitiver DNA und assoziierten Proteinen bestehenden Enden der Chromosomen. Die wiederholte Sequenz (Repeatsequenz) und die durch diese Wiederholung bedingte Länge sind hierbei in verschiedenen Organismen unterschiedlich. Bei Wirbeltieren wird die Sequenz TTAGGG mehrere tausend Mal wiederholt und ist dementsprechend mehrere Kilo-Basenpaare (kbp) lang. Telomere sind die für die Stabilität von Chromosomen wesentlichen Strukturelemente der DNA. Für den Stabilisierungseffekt ist auch die gefaltete Sekundärstruktur der Telomere wichtig.

Struktur der Telomere[Bearbeiten]

Die exakte räumliche Struktur der Telomere ist bisher noch nicht endgültig geklärt. Sie hängt von der Basensequenz ab, sodass durchaus mehrere Bindungsmotive auftreten können.

Bei höheren Eukaryoten findet man ein typisches thymin- und guaninreiches Motiv, bei dem man davon ausgeht, dass es eine Quadrupelhelix ausbildet. Dabei paart sich zuerst der 3'-überlappende Strang mit sich selbst und bildet abnormale GG-Doppelbindungen aus. Dieser Doppelstrang paart sich erneut mit sich selbst und bildet eine Quadrupelhelix aus, bei der die Guanine sogenannte Hoogsteen-Bindungen eingehen.

Diese DNA-Sequenz wird von spezifischen DNA-bindenden Proteinen erkannt und gebunden. Dieser Proteinkomplex hat die Aufgabe, es der Zelle zu ermöglichen, das natürliche Chromosomenende von ungewollten DNA-Strangbrüchen zu unterscheiden.

Telomere bei der Replikation[Bearbeiten]

Mit jeder Zellteilung werden die Telomere verkürzt, da die DNA-Polymerase am Folgestrang nicht mehr ansetzen kann. Unterschreitet die Telomerlänge ein kritisches Minimum von circa 4 kbp, kann sich die Zelle nicht mehr weiter teilen. Oft tritt dann der programmierte Zelltod (Apoptose) oder ein permanenter Wachstumsstopp ein (Seneszenz). Die hierdurch entstehende Begrenzung der zellulären Lebenszeit wird als Tumorsuppressor-Mechanismus verstanden.

Das Enzym Telomerase (ein RNA-Protein-Komplex mit einer reverse-Transkriptase-Aktivität) kann die Verkürzung wieder ausgleichen. Dazu fügt sie an das 3'-OH-Ende G-reiche Wiederholungseinheiten an, deren RNA-Vorlage sich in der Telomerase selbst befindet. Danach klappt der Leitstrang um und bildet mit sich selbst abnormale GG-Basenpaarungen aus. Von diesem Punkt aus können die RNA-Primase und die DNA-Polymerase den Folgestrang (auch Rückwärtsstrang oder diskontinuierlicher Strang genannt) auffüllen. Zellen, in denen dieses Enzym aktiv ist, können sich sehr viel häufiger teilen als andere Körperzellen. Aktiv ist die Telomerase prinzipiell bei einzelligen Eukaryoten (Protozoen), bei höheren mehrzelligen Organismen jedoch nur in ganz bestimmten Zellen:

Es hat sich allerdings bei Knock-out-Mäusen gezeigt, dass sie mehrere Generationen ohne Telomerase lebensfähig bleiben können. Es wird angenommen, dass die Reparatur der Telomere auch über Rekombinationsereignisse vonstattengehen kann; geklärt ist dies aber noch nicht.

Bedeutung[Bearbeiten]

Die Bedeutung der Chromosomenenden für deren Stabilität erkannten erstmals die amerikanischen Nobelpreisträger Barbara McClintock und Hermann Joseph Muller, die auch den Begriff Telomer (griechisch für End-Teil) prägten. Telomere werden mit biologischen Vorgängen in Verbindung gebracht, die mit der Alterung von Zellen (Zellseneszenz) zusammenhängen sowie mit deren Immortalisierung und damit auch der Entstehung von Krebs.

Die Enzymaktivität der Telomerase lässt sich durch die TRAP-Methode feststellen.

Beispiele für Sequenzen von Telomeren bei verschiedenen Organismen
Gruppe (Reich, Stamm) Organismus Telomerische Wiederholungseinheit (5' nach 3')
Wirbeltiere Mensch, Hausmaus, Xenopus TTAGGG
Filamentöse Pilze (Fungi) Neurospora crassa TTAGGG
Fadenwürmer (Nematoda) Caenorhabditis elegans TTAGGG
Schleimpilze Physarum, Didymium
Dictyostelium
TTAGGG
AG(1-8)
Kinetoplastiden (Protozoa) Trypanosoma, Crithidia TTAGGG
Ciliata (Wimpertierchen, Protozoa) Tetrahymena, Glaucoma
Paramecium
Oxytricha, Stylonychia, Euplotes
TTGGGG
TTGGG(T/G)
TTTTGGGG
Apicomplexa (Plasmodium, Protozoa) TTAGGG(T/C)
Höhere Pflanzen Arabidopsis thaliana TTTAGGG
Grünalgen Chlamydomonas TTTTAGGG
Insekten Bombyx mori TTAGG
Schlauchwürmer Ascaris lumbricoides TTAGGC
Spalt-Hefen (Schizosaccharomyces) Schizosaccharomyces pombe TTAC(A)(C)G(1-8)
Knospungs-Hefen Saccharomyces cerevisiae TGTGGGTGTGGTG (vom RNA-Template)

or G(2-3)(TG)(1-6)T (Konsensus)

Candida glabrata GGGGTCTGGGTGCTG
Candida albicans GGTGTACGGATGTCTAACTTCTT
Candida tropicalis GGTGTA(C/A)GGATGTCACGATCATT
Candida maltosa GGTGTACGGATGCAGACTCGCTT
Candida guillermondii GGTGTAC
Candida pseudotropicalis GGTGTACGGATTTGATTAGTTATGT
Kluyveromyces lactis GGTGTACGGATTTGATTAGGTATGT

Einflüsse[Bearbeiten]

Der Einfluss von chronischem Stress auf die beschleunigte Verkürzung der Telomere wird über den Haushalt der Nachrichtenstoffe Dopamin und Serotonin vermittelt.[1]

Belletristik[Bearbeiten]

1999 behandelte der amerikanische Schriftsteller John Darnton das Thema Telomere in seinem Roman Zwillingspark (The Experiment).[2]

Literatur[Bearbeiten]

  • Barbara McClintock: The stability of broken ends of chromosomes in Zea mays. In: Genetics. Band 26, 1941, S. 234–282.
  • H. J. Müller: The remaking of chromosomes. In: The Collecting Net-Woods Hole. Band 13, 1938, S. 181–198.
  • E. S. Epel, E. H. Blackburn u. a.: Accelerated telomere shortening in response to life stress. In: Proc Natl Acad Sci U S A. Band 101, Nr. 5014. Dezember 2004, S. 17323–17324.
  • M. Mills, L. Lacroix u. a.: Unusual DNA conformations: Implications for telomeres. In: Current Medicinal Chemistry - Anti-Cancer Agents. Band 2, Nr. 5, September 2002, S. 627–644.
  • Guenther Witzany: The viral origins of telomeres, telomerases and their important role in eukaryogenesis and genome maintenance. In: Biosemiotics. Band 1, 2008, S. 191–206.

Einzelnachweise[Bearbeiten]

  1. Martin Winkelheide: Genetik. Der soziale Status lässt sich an den Chromosomenenden ablesen. Auf: Deutschlandfunk.de.Forschung aktuell“ vom 7. April 2014. Primärquelle: PNAS.
  2. Seite 244 ff.