Telomer

aus Wikipedia, der freien Enzyklopädie
Wechseln zu: Navigation, Suche
Übergeordnet
Chromosom
Untergeordnet
Proteinkomplexe
Gene Ontology
QuickGO

Die Telomere (gr. τέλος télos „Ende“ und μέρος méros „Teil“) sind die aus repetitiver DNA und assoziierten Proteinen bestehenden Enden der Chromosomen. Die wiederholte Sequenz (Repeatsequenz) und die durch diese Wiederholung bedingte Länge sind hierbei in verschiedenen Organismen unterschiedlich. Bei Wirbeltieren wiederholen sich "Hexanukleotide", also die sechs Nukleotide mit der Sequenz TTAGGG mehrere tausend Mal. Das Telomer ist dementsprechend mehrere Kilo-Basenpaare (kbp) lang. Telomere sind die für die Stabilität von Chromosomen wesentlichen Strukturelemente der DNA. Für den Stabilisierungseffekt ist auch die gefaltete Sekundärstruktur der Telomere wichtig.

Struktur der Telomere[Bearbeiten | Quelltext bearbeiten]

Bei höheren Eukaryoten findet man ein typisches thymin- und guaninreiches Motiv, bei dem man davon ausgeht, dass es eine Quadrupelhelix ausbildet. Dabei paart sich zuerst der 3'-überlappende Strang mit sich selbst und bildet abnormale GG-Doppelbindungen aus. Dieser Doppelstrang paart sich erneut mit sich selbst und bildet eine Quadrupelhelix aus, bei der die Guanine sogenannte Hoogsteen-Bindungen eingehen.

Diese DNA-Sequenz wird vom DNA-bindenden Proteinkomplex Shelterin erkannt und gebunden. Dieser Proteinkomplex hat die Aufgabe, es der Zelle zu ermöglichen, das natürliche Chromosomenende von ungewollten DNA-Strangbrüchen zu unterscheiden.

Telomere bei der Replikation[Bearbeiten | Quelltext bearbeiten]

Mit jeder Zellteilung werden die Telomere verkürzt, da die DNA-Polymerase am Folgestrang nicht mehr ansetzen kann. Unterschreitet die Telomerlänge ein kritisches Minimum von circa 4 kbp, kann sich die Zelle nicht mehr weiter teilen. Oft tritt dann der programmierte Zelltod (Apoptose) oder ein permanenter Wachstumsstopp ein (Seneszenz). Die hierdurch entstehende Begrenzung der zellulären Lebenszeit wird als Tumorsuppressor-Mechanismus verstanden. Erfolgt trotz verkürzter Telomere eine weitere Zellteilung, wie in einigen Krebszellen, kommt es zu einer zunehmenden Chromosomen-Instabilität.

Das Enzym Telomerase (ein RNA-Protein-Komplex mit einer reverse-Transkriptase-Aktivität) kann die Verkürzung wieder ausgleichen. Dazu fügt sie an das 3'-OH-Ende G-reiche Wiederholungseinheiten an, deren RNA-Vorlage sich in der Telomerase selbst befindet. Danach klappt der Leitstrang um und bildet mit sich selbst abnormale GG-Basenpaarungen aus. Von diesem Punkt aus können die RNA-Primase und die DNA-Polymerase den Folgestrang (auch Rückwärtsstrang oder diskontinuierlicher Strang genannt) auffüllen. Zellen, in denen dieses Enzym aktiv ist, können sich sehr viel häufiger teilen als andere Körperzellen. Aktiv ist die Telomerase prinzipiell bei einzelligen Eukaryoten (Protozoen), bei höheren mehrzelligen Organismen jedoch nur in ganz bestimmten Zellen:

Es hat sich allerdings bei Knock-out-Mäusen gezeigt, dass sie mehrere Generationen ohne Telomerase lebensfähig bleiben können. Es wird angenommen, dass die Reparatur der Telomere auch über Rekombinationsereignisse vonstattengehen kann; geklärt ist dies aber noch nicht.

Bedeutung[Bearbeiten | Quelltext bearbeiten]

Die Bedeutung der Chromosomenenden für deren Stabilität erkannten erstmals die amerikanischen Nobelpreisträger Barbara McClintock und Hermann Joseph Muller, die auch den Begriff Telomer (griechisch für End-Teil) prägten. Telomere werden mit biologischen Vorgängen in Verbindung gebracht, die mit der Alterung von Zellen (Zellseneszenz) zusammenhängen sowie mit deren Immortalisierung und damit auch der Entstehung von Krebs.

Die Enzymaktivität der Telomerase lässt sich durch die TRAP-Methode feststellen.

Beispiele für Sequenzen von Telomeren bei verschiedenen Organismen
Gruppe (Reich, Stamm) Organismus Telomerische Wiederholungseinheit (5' nach 3')
Wirbeltiere Mensch, Hausmaus, Xenopus TTAGGG
Filamentöse Pilze (Fungi) Neurospora crassa TTAGGG
Fadenwürmer (Nematoda) Caenorhabditis elegans TTAGGG
Schleimpilze Physarum, Didymium
Dictyostelium
TTAGGG
AG(1-8)
Kinetoplastiden (Protozoa) Trypanosoma, Crithidia TTAGGG
Ciliata (Wimpertierchen, Protozoa) Tetrahymena, Glaucoma
Paramecium
Oxytricha, Stylonychia, Euplotes
TTGGGG
TTGGG(T/G)
TTTTGGGG
Apicomplexa (Plasmodium, Protozoa) TTAGGG(T/C)
Höhere Pflanzen Arabidopsis thaliana TTTAGGG
Grünalgen Chlamydomonas TTTTAGGG
Insekten Bombyx mori TTAGG
Schlauchwürmer Ascaris lumbricoides TTAGGC
Spalt-Hefen (Schizosaccharomyces) Schizosaccharomyces pombe TTAC(A)(C)G(1-8)
Knospungs-Hefen Saccharomyces cerevisiae TGTGGGTGTGGTG (vom RNA-Template)

oder G(2-3)(TG)(1-6)T (Konsensus)

Candida glabrata GGGGTCTGGGTGCTG
Candida albicans GGTGTACGGATGTCTAACTTCTT
Candida tropicalis GGTGTA(C/A)GGATGTCACGATCATT
Candida maltosa GGTGTACGGATGCAGACTCGCTT
Candida guillermondii GGTGTAC
Candida pseudotropicalis GGTGTACGGATTTGATTAGTTATGT
Kluyveromyces lactis GGTGTACGGATTTGATTAGGTATGT

Einflüsse[Bearbeiten | Quelltext bearbeiten]

Der Einfluss von chronischem Stress auf die beschleunigte Verkürzung der Telomere wird über den Haushalt der Nachrichtenstoffe (Neurotransmitter) Dopamin und Serotonin vermittelt.[1] Moderate Veränderungen des Lebensstils können zu einer Verlängerung der Telomere führen.[2]

Telomeropathie[Bearbeiten | Quelltext bearbeiten]

Bei Mutationen der Gene für Proteine, die für den Schutz, die "Wartung" und Reparatur der Telomere zuständig sind, kommt es zu deutlich verkürzten Telomeren. Dies betrifft vor allem den Komplex der Shelterine und den Telomerase Komplex. Daraus resultiert ein deutlich verminderter Pool an Stammzellen mit geringerer regenerativer "Qualität", die eine Gruppe chronischer Krankheiten auslösen, die als Telomer-Krankheiten oder Telomeropathien bezeichnet werden:

Die Telomeropathien sind genetisch sehr heterogen mit hoher Variabilität der Penetranz.

Bereits in den 1960er Jahren wurden Androgene zur Therapie des Knochenmarkversagens erfolgreich eingesetzt. Versuche in vitro konnten an menschlichen Lymphozyten und menschlichen CD34-positiven hämatopoetischen Stammzellen zeigen, dass Androgene die Genexpression für die reverse Telomerase-Transferase (TERT) und die enzymatische Aktivität der Telomerase steigern können. Dies kann bei Mäusen mit Telomer-Insuffizienz sogar zu einer hämatologischen Verbesserung und einer Verlängerung der Telomerlänge führen.

Eine erste prospektive Phase-1/2-Studie mit der Gabe des synthetischen Androgens Danazol (800 mg täglich für 24 Monate) musste wegen unerwartet starker Wirkung vorzeitig gestoppt werden, weil bei einer Zwischenanalyse bei allen zwölf bis dahin auswertbaren Patienten der primäre Endpunkt erreicht war, die Telomerschädigung nicht weiter zunahm. Bei elf Patienten waren nach 24 Monaten Therapie die Telomere sogar länger als zu Beginn (92 %)mit einer mittleren Verlängerung um 386 Basenpaare vorwiegend im ersten Behandlungsjahr. Bei 19 der 24 Patienten (79 %), die bis zum Stopp der Studie mindestens drei Monate behandelt worden waren, konnte eine hämatologische Verbesserung festgestellt werden. Während vor Studienbeginn 13 Patienten regelmäßige Bluttransfusionen benötigten, war dies bei Studienabbruch nur noch ein Patient.[3]

Diese Studie gibt Anlass zu einer größeren randomisierten kontrollierten Studie, jedoch kann aus dieser kleinen Studie mit wenigen Teilnehmer noch keine Therapieempfehlung für die Praxis abgeleitet werden, da vor allem Risiken, langfristige und unerwünschte Wirkungen nicht erfasst werden konnten.[4]

Belletristik[Bearbeiten | Quelltext bearbeiten]

1999 behandelte der amerikanische Schriftsteller John Darnton das Thema Telomere in seinem Roman Zwillingspark (The Experiment).[5]

Literatur[Bearbeiten | Quelltext bearbeiten]

  • Barbara McClintock: The stability of broken ends of chromosomes in Zea mays. In: Genetics. Band 26, 1941, S. 234–282.
  • H. J. Müller: The remaking of chromosomes. In: The Collecting Net-Woods Hole. Band 13, 1938, S. 181–198.
  • E. S. Epel, E. H. Blackburn u. a.: Accelerated telomere shortening in response to life stress. In: Proc Natl Acad Sci U S A. Band 101, Nr. 5014. Dezember 2004, S. 17323–17324.
  • M. Mills, L. Lacroix u. a.: Unusual DNA conformations: Implications for telomeres. In: Current Medicinal Chemistry - Anti-Cancer Agents. Band 2, Nr. 5, September 2002, S. 627–644.
  • Guenther Witzany: The viral origins of telomeres, telomerases and their important role in eukaryogenesis and genome maintenance. In: Biosemiotics. Band 1, 2008, S. 191–206.

Einzelnachweise[Bearbeiten | Quelltext bearbeiten]

  1. Martin Winkelheide: Genetik. Der soziale Status lässt sich an den Chromosomenenden ablesen. Deutschlandfunk. Forschung aktuell, 7. April 2014. Primärquelle: PNAS.
  2. Effect of comprehensive lifestyle changes on telomerase activity and telomere length …. Auf: thelancet.com.
  3. Danielle M. Townsley, Bogdan Dumitriu, Delong Liu, Angélique Biancotto, Barbara Weinstein, Christina Chen, Nathan Hardy, Andrew D. Mihalek, Shilpa Lingala, Yun Ju Kim, Jianhua Yao, Elizabeth Jones, Bernadette R. Gochuico, Theo Heller, Colin O. Wu, Rodrigo T. Calado, Phillip Scheinberg, Neal S. Young: Danazol Treatment for Telomere Diseases. New England Journal of Medicine 2016; Band 374, Ausgabe 20 vom 19. März 2016, Seiten 1922-1931; DOI:10.1056/NEJMoa1515319
  4. Peter M: Lansdorp: Telomeres on Steroids - Tuning back teh mitotic clock?. New England Journal of Medicine 2016; Band 374, Ausgabe 20 vom 19. März 2016, Seiten 1978-1980; DOI:10.1056/NEJMe1602822
  5. S. 244 ff.